65 hours. The mean Vss was 20.1 L, and the CL was 598.3 mL/min. The active metabolite M3 showed a biphasic decline in concentration after reaching Cmax values (mean t½ 1.69 hours), whereas the decline of M4 appeared monophasic (mean t½ 0.52 hours). The concentrations of these metabolites were substantially lower than those of bendamustine. The concentrations of the dihydrolysis product HP2 were initially also much lower than the concentrations of bendamustine but, unlike the other analytes, small but measurable

levels of HP2 were still present at 24 hours after the start of the infusion, with a mean concentration at 24 hours selleckchem of 3.75 ng/mL. The TRA concentrations were characterized by a very slow decrease after reaching Cmax values. After 168 hours, the mean

TRA concentration was still 2.29 μg Eq/mL, and the mean t½ of the apparent terminal phase was estimated at 197 hours (Table 2). Bendamustine, M3, M4, and HP2 composed the bulk of the TRA early in the profile (almost 80%); however, their contribution to the TRA quickly declined to approximately 1% at 4 hours after the start of the infusion. Selleck FK506 The mean concentration ratio of TRA in plasma and in whole blood (Fig. 3) was ~1.4

immediately after the end of the infusion and approximately 1 at later time points. Fig. 3 Mean (±standard deviation) [n = 4–6] plasma to whole-blood concentration ratio of total radioactivity immediately after the end of a 60-minute (120 mg/m2, 80–95 μCi) 14C-bendamustine hydrochloride infusion and at Methamphetamine weekly time points thereafter. TRA total radioactivity 3.3 Excretion Balance For all six patients, urine and fecal samples were collected as planned during the first 168 hours after administration of 14C-bendamustine. Thereafter, urine and feces continued to be collected for longer periods in five and three patients, respectively, for up to 3 weeks. Figure 4 shows the mean cumulative urinary, fecal, and total recovery of TRA during 168 hours after 14C-bendamustine administration. At this point, approximately half (45.5%) of the administered radioactivity was recovered in urine and a quarter (25.2%) in feces, resulting in total recovery of 70.6% after 168 hours. After the extended collection period, the total recovery was increased to 76.0%. Individual excretion values are tabulated in Table 3. Fig.

The integrity of circulating DNA, measured as the ratio of longer to shorter DNA fragments, is higher in cancer patients than in normal individuals [58]. Apoptotic

cells release DNA fragments that are usually 185 to 200 base pairs selleck in length. Uniformly truncated fragments of DNA (and RNA) are produced by a programmed enzymatic cleavage process during apoptosis [59]. As we and other groups have reported, methylation of tumor suppression genes detected in circulating DNA is associated with prognosis [60]. We speculate that the high rate of unscheduled cell death in the tumor microenvironment elevates nucleic acid DAMPs. Elevated levels of nucleic acid DAMPs and other DAMPs might foster chronic inflammation, a hallmark of the tumor microenvironment. Figure 3 shows how interactions between TLRs and DAMPs could create and maintain a self-perpetuating tumor microenvironment. In this microenvironment, cancer cell death might stimulate cancer progression if nucleic acid fragments released by the dead tumor cells are transfected into normal cells, thereby changing the normal cell’s properties. Normal cells in the tumor microenvironment might also be transfected by microRNA released from tumor cells, because these small

RNA molecules (20–22 base pairs) are easily taken up by cells. Horizontal mediated transfection of microRNA and mRNA in mammalian cells is an intriguing possibility but has yet to be demonstrated Peptide 17 in vivo. This phenomenon could explain the expression of tumor-related proteins by normal cells in the tumor microenvironment. Fig. 3 During cancer growth and unscheduled cell death, DAMPs derived from necrotic cancer cells might continuously activate TLRs and create a chronic inflammatory condition as well as PAMPs. TLR ligation activates NF-κB and MAPK signaling, causing the production of proinflammatory cytokines

and chemokines. The resulting aberrant molecular pattern of cytokines/chemokines might have a crucial role in immunotolerance, maintain tumor microenvironment, tumor angiogenesis that supports tumor progression Fossariinae TLR-targeted Therapies Because several TLRs can induce strong anti-tumor activity by regulating the functions of immune cells that infiltrate the tumor microenvironment, clinical trials are investigating novel anticancer therapies based on TLR ligand delivery. A successful example is imiquimod. This TLR7 agonist is used extensively to treat actinic keratosis and basal cell carcinoma, and it is being studied as an adjuvant therapy for melanoma. A study of imiquimod 5% cream in 90 patients with basal cell carcinoma reported a 96% clearance rate, and only two recurrences during application a mean follow-up period of 36 months. Cutaneous side effects were minimal; there were no systemic side effects [61].

Jpn J Med Mycol 2007, 48:37–46.CrossRef 9. Balajee SA, Houbraken J, Verweij PE, Hong SB, Yaghuchi T, Varga J, Samson RA: Aspergillus species identification in the clinical setting. Stud Mycol 2007, 59:39–46.PubMedCrossRef 10. Brandt ME, Padhye AA, Mayer LW, Holloway BP: Utility of random amplified polymorphic DNA PCR and TaqMan automated detection in molecular identification of Idelalisib Aspergillus fumigatus . J Clin Microbiol 1998, 36:2057–2062.PubMed 11. Hong SB, Go SJ, Shin HD, Frisvad JC, Samson RA: Polyphasic taxonomy of Aspergillus

fumigatus and related species. Mycologia 2005, 97:1316–1329.PubMedCrossRef 12. Staab JF, Balajee SA, Marr KA: Aspergillus Section Fumigati typing by PCR-restriction fragment polymorphism. J Clin Microbiol 2009, 47:2079–2083.PubMedCrossRef 13. Etienne KA, Gade L, Lockhart SR, Diekema DJ, Messer SA, Pfaller MA, Balajee SA: Screening of a large global Aspergillus fumigatus species complex collection by using a species-specific microsphere-based Luminex assay. RAD001 concentration J Clin Microbiol 2009, 47:4171–4172.PubMedCrossRef 14. Guarro J, Kallas EG, Godoy P, Karenina A,

Gené J, Stchigel A, Colombo AL: Cerebral aspergillosis caused by Neosartorya hiratsukae , Brazil. Emerg Infect Dis 2002, 8:989–991.PubMed 15. Padhye AA, Godfrey JH, Chandler FW, Peterson SW: Osteomyelitis caused by Neosartorya pseudofischeri . J Clin Microbiol 1994, 32:2832–2836.PubMed 16. Sugui JA, Vinh DC, Nardone G, Shea YR, Chang YC, Zelazny AM, Marr KA, Holland SM, Kwon-Chung KJ: Neosartorya udagawae ( Aspergillus udagawae) , an emerging agent of aspergillosis: how different is it from Aspergillus fumigatus ? J Clin Microbiol 2010, 48:220–228.PubMedCrossRef 17. Vinh DC, Shea YR, Sugui JA, Parrilla-Castellar

ER, Freeman AF, Campbell JW, Pittaluga S, Jones PA, Zelazny Adenosine A, Kleiner D, Kwon-Chung KJ, Holland SM: Invasive aspergillosis due to Neosartorya udagawae . Clin Infect Dis 2009, 49:102–111.PubMedCrossRef 18. Vinh DC, Shea YR, Jones PA, Freeman AF, Zelazny A, Holland SM: Chronic invasive aspergillosis caused by Aspergillus viridinutans . Emerg Infect Dis 2009, 15:1292–1294.PubMedCrossRef 19. Araujo R, Pina-Vaz C, Rodrigues AG: Susceptibility of environmental versus clinical strains of pathogenic Aspergillus . Int J Antimicrob Agents 2007, 29:108–111.PubMedCrossRef 20. Araujo R, Coutinho I, Espinel-Ingroff A: Rapid method for testing the susceptibility of Aspergillus fumigatus to amphotericin B, itraconazole, voriconazole and posaconazole by assessment of oxygen consumption. J Antimicrob Chemother 2008, 62:1277–1280.PubMedCrossRef 21. Cruz-Perez P, Butner MP, Stetzenbach LD: Detection and quantitation of Aspergillus fumigatus in pure culture using polymerase chain reaction. Mol Cell Probes 2001, 15:81–88.PubMedCrossRef 22. Klingspor L, Loeffler J: Aspergillus PCR formidable challenges and progress. Med Mycol 2009, 47:S241-S247.PubMedCrossRef 23.

References 1. WHO: Leishmaniasis: magnitude of the problem. World Health Org 2013. [http://​www.​who.​int/​leishmaniasis/​burden/​magnitude/​burden_​magnitude/​en/​]URL 2. Fernández-Guerrero ML, Robles P, Rivas P, Mójer F, Muñíz G, Górgolas M: Visceral leishmaniasis in immunocompromised patients with and without AIDS: a comparison of clinical features and prognosis. Acta Trop 2004, 90:11–16.PubMedCrossRef 3. Carnaúba-Jr

D, Konishi CT, Petri V, Martinez ICP, Shimizu L, Pereira-Chioccola VL: Atypical disseminated leishmaniasis similar to post-kala-azar dermal leishmaniasis in a Brazilian AIDS patient infected with Leishmania ( Leishmania ) infantum chagasi DMXAA : a case report. Int J Infect Dis 2009, 13:504–507.CrossRef 4. Barral A, Pedral-Sampaio D, Grimaldi Júnior G, Momen H, McMahon-Pratt D, Ribeiro De Jesus A, Almeida R, Badaro R, Barral-Netto M, Carvalho EM, Johnson Júnior WD: Leishmaniasis in Bahia, Brazil: evidence that Leishmania amazonensis produces a wide spectrum of clinical disease. Am selleck compound J Trop Med Hyg 1991, 44:536–546.PubMed 5. Oliveira JPC, Fernandes F, Cruz AK, Trombela V, Monteiro E, Camargo AA, Barral A, Oliveira CI: Genetic diversity of Leishmania amazonensis strains isolated in northeastern Brazil as revealed by DNA sequencing, PCR-based analyses and molecular karyotyping. Kinetoplastid Biol

Dis 2007. doi:10.1186/1475–9292–6-5CrossRef 6. Croft SL, Coombs GH: Leishmaniasis – current chemotherapy and recent advances in the search for novel drugs. Trends

Parasitol 2003, 19:502–508.PubMedCrossRef 7. Tiuman TS, Santos AO, Ueda-Nakamura T, Dias Filho BP, Nakamura CV: Recent advances in leishmaniasis treatment. Int J Infect Dis 2011, 15:e525-e532.PubMedCrossRef 8. Croft SL, Sundar S, Fairlamb AH: Drug resistance in leishmaniasis. Clin Microbiol Rev 2006, 19:111–126.PubMedCentralPubMedCrossRef 9. Natera S, Machuca C, Padrón-Nieves M, Romero A, Lck Díaz E, Ponte-Sucre A: Leishmania spp.: proficiency of drug-resistant parasites. Int J Antimicrob Agents 2007, 29:637–642.PubMedCrossRef 10. Tiuman TS, Ueda-Nakamura T, Cortez DAG, Dias Filho BP, Morgado-Díaz JA, De Souza W, Nakamura CV: Antileishmanial activity of parthenolide, a sesquiterpene lactone isolated from Tanacetum parthenium . Antimicrob Agents Chemother 2005, 49:176–182.PubMedCentralPubMedCrossRef 11. Tiuman TS, Ueda-Nakamura T, Dias-Filho BP, Cortez DAG, Morgado-Díaz JA, Nakamura CV: Morphologic and ultrastructural alterations in Leishmania amazonensis induced by 4a,5β-epoxy-germacra-1(10),11(13)-dien-12,6a-olide. Acta Protozool 2007, 46:349–355. 12. Linsinger G, Wilhelm S, Wagner H, Häcker G: Uncouplers of oxidative phosphorylation can enhance a Fas death signal. Mol Cell Biol 1999, 19:3299–3311.PubMedCentralPubMed 13.

Surgical decompression is the last but the most effective way to decrease IAP and should not be postponed too late if patient has developed ACS [10]. Patients with acute pancreatitis have a considerable risk for developing secondary infections including bacteremia, pneumonia and infection of pancreatic or peripancreatic necrosis. Extrapancreatic infections occur predominantly during the first week of illness, whereas pancreatic necrosis check details becomes infected later [11]. The mortality is very high in patients with persistent organ failure complicated with infected pancreatic necrosis [12]. Development of bacteremia and infected pancreatic necrosis are associated with MODS. Intestinal dysfunction

plays an important role and bacterial translocation from intestine is considered the main mechanism of infection. Impaired host response systems may also predispose to clinical infections. Early enteral nutrition has been shown to reduce systemic infections [13], whereas the results from randomized trials with prophylactic antibiotics have been inconclusive [14]. Surgery is considered necessary for adequate source control when pancreatic or peripancreatic infection develops. However, because surgery for pancreatic necrosis within

the first 2–3 weeks from disease onset is associated with high mortality, surgery should be postponed as late as possible [15]. Sometimes percutaneous drainage of fluid from infected acute necrotic collection may be helpful and is preferable first-line treatment for infected pancreatic necrosis during selleck screening library Clomifene the first three weeks of illness [16]. Fluid resuscitation and abdominal compartment syndrome Aggressive fluid therapy during the early phase of acute pancreatitis has been traditionally the cornerstone of treatment [17]. The rationale of fluid therapy is to

correct hypovolemia caused by third space fluid loss. High admission hematocrit (above normal reference limits) may serve as a marker of hemoconcentration, and it is present up to 60% of patients who develop organ failure [18], but the marker is too unspecific for predictive purposes [19]. Fluid resuscitation decreases hematocrit, which could be used as resuscitation end-point. Too aggressive resuscitation may lead to inappropriate hemodilution and very low hematocrit values (<30%) may be harmful for the patients by increasing the risk of sepsis and death [20]. Moreover, excess volume loading may increase IAP and lead to development of intra-abdominal hypertension (IAH) and abdominal compartment syndrome [21]. In patients with acute pancreatitis, hematocrit and central venous pressure as resuscitation end-points are poor indicators of volume depletion [22]. Urine output (≥0.5 ml/kg/h) may serve as another resuscitation end-point, but other modalities are needed for volume management if oliguria persists after initial volume loading.

Mice were housed in microisolator cages in a specific pathogen-free (SPF) condition with 12-hr light-dark cycles. Mice were subcutaneously implanted with 1 × 107 5637 cells. Once tumors reached approximately 60 μL in volume, the mice were allocated to receive either ASODN or MSODN treatment, with the concentration of 200 nmol/L and 0.2 ml/mice. The nude mice injected with ASODN were termed as treatment group and the nude mice injected with MSODN were termed as control group. Complexes of ASODN or MSODN plus 4 μL invivo-jetPEI™ (polyplus-transfection

Inc., U.S.A.) and also plus 160 μL 5% glucose were directly injected into the tumor once every other day with a total of 7 times. Tumor dimensions were measured once every three days and the tumor AZD2014 mw volumes calculated using the formula: 1/2 × a × b2, where a and b respectively represented the larger and smaller tumor diameter. At the end of the treatment, mice were killed by overdose of ketamine (400 mg/kg) and xylazine (50 mg/kg) and necropsy was performed. Tumor tissue samples were prepared for Immunohistochemistry or TUNEL cell apoptosis detection. Tumor growth inhibition (TGI) was calculated using the formula TGI (%) = (1-MT/MC) LY2835219 molecular weight × 100, where MT and MC are the mean tumor masses in the treatment group and control group respectively. TUNEL analyses for cell apoptosis detection For detection of apoptosis, TUNEL analyses were performed using the in

situ cell death detection kit (Roche Molecular Biochemicals, USA). Operations were carried very out according to kit instructions. 10 high-powerfields were selected for each case. Count the

number of apoptotic cells and total number of cells for each powerfield to calculate the percentage of apoptotic cells (number of apoptotic cells in each powerfield/total cell number in each powerfield) i.e., apoptosis index (AI). . Statistical analysis The results were expressed as mean ± standard deviation. One-way analysis of variance (ANOVA) was used to determine the levels of difference between all groups. Comparisons for all pairs were made using Student-Newman-Keuls (SNK) test. p < 0.05 was considered statistically significant. Results Livin antisense oligonucleotide dose-dependently inhibit bladder cancer cell growth After transfected with different concentrations of Livin antisense oligonucleotides, cell growth of bladder cancer cell lines was determined by MTT and an obvious dose-dependently inhibitory effect was found (Fig 1). When the Livin antisense oligonucleotide concentration was 160 nmol/L, the cell growth inhibition rate reached 92.61 percent, although reagent concentration was continuously increasing, the inhibition rate will not increase significantly (P > 0.05). Accordingly, we chose 160 nmol/L oligonucleotide as the suitable concentration for further study. Figure 1 Inhibitory rate of 5637 cells transfected with Livin ASODN.

The quantitative level of PRDM1α mRNA was normalized to β-actin using the cycle threshold (Ct) method (2-△△Ct method). For each sample, 3 independent experiments were made with triplicates for each experiment. Samples from plasma cell myeloma and tonsil were used as positive controls for PRDM1α FK228 purchase mRNA detection. ISH detection ISH for miR-223, miR-886-3p, and miR-34c-5p was performed for 31 EN-NK/T-NTs, 10 peripheral T-cell lymphomas, and 13 inflammatory nasal mucosa specimens. The presence of NK cells within the inflammatory nasal mucosa specimens were identified

by CD56 immunostaining. Probes labelled with a locked nuclear acid (LNA)™ probe for miR-223, miR-886-3p, and miR-34c-5p were designed and generated by Bio Perfectus Technologies (Jiang-su, China) according to sequences in the miRbase (Table 1). DMXAA Table 1 Sequences of in situ hybridisation probes for miR-223, miR-886-3p,

and miR-34c-5p miRNA MiRbase no. Genomic location Probe hsa-miR-223 MIMAT0000280 Xq12 5′-TGGGGTATTTGACAAACTGACA-3′ hsa-miR-886-3p MIMAT0004906 5q31.1 5′-AAGGGTCAGTAAGCACCCGCG-3′ hsa-miR-34c-5p MIMAT0000686 11q23.1 5′-GCAATCAGCTAACTACACTGCCT-3′ The ISH assays for miRNAs were performed as follows: FFPE tissues were routinely deparaffinised in xylene and rehydrated with an ethanol gradient, treated with 1 mg/ml Proteinase K for 10 min at 37°C, fixed with 4% formaldehyde for 10 min, and then dehydrated in ice-cold 90% ethanol. A 20-μL volume of hybridisation mixture consisting of 2 μL of the indicated LNA™ probe and 18 μL of a solution of 200 μg/mL salmon sperm DNA, 1 mg/mL dithiothreitol (DTT), 50% formamide, 2× Denhardt’s, 1 mg/mL

polyglucosan, and 2× saline-sodium citrate (2× SSC) was applied to each slide. The hybridisation reactions were performed overnight at 42°C in a humidified chamber. The sections were stringently rinsed 3 times for 15 min each in 2× SSC at 37°C, and endogenous peroxidases were blocked with 10% H2O2 for 20 min. After 2 washes in 1× PBS for 10 min, the slides were blocked with goat serum (1:100) for 30 min. The slides were then incubated with mouse anti-digoxin antibody for 20 h at 4°C. The slides were washed twice with 1× PBS, incubated with polymer auxiliary agent for 30 min, and washed with 1× PBS (-)-p-Bromotetramisole Oxalate for 10 min. Goat anti-mouse secondary antibody was added to the slides. After 2 washes with 1× PBS, DAB staining was performed. miR-223-, miR-886-3p-, or miR-34c-5p-positive EN-NK/T-NT tissue was used as a positive control for miR-223, miR-886-3p, or miR-34c-5p staining, respectively. For negative control samples, the hybridisation reactions were performed with a sense probe. Cytoplasmic staining was interpreted as miRNA expression, and positive expression was defined as staining of 10% or more of the cells in each tumour. The grading was semi-quantitatively estimated as follows: negative (0% to <10%), weak (10% to ≤50% positive cells), or strong (>50% to 100% positive cells).

We suggest that the metabolism of pyruvate via the PoxB

route compensates for reduced activities of Fe-S cluster enzymes in the TCA cycle. The pathway catalyzed by PoxB is iron-independent. The E. coli ortholog, a thiamin/flavin-dependent enzyme activated by binding to IM phospholipids, Dabrafenib ic50 was shown to feed electrons directly from the cytosol to the respiratory chain [52]. To our knowledge, this is the first report linking enhanced PoxB activities in bacteria specifically to iron starvation. PoxB is a potential drug target in the context of intracellular pathogens surviving in environments where iron is sequestered. Conclusions Proteomic surveys of Y. pestis subcellular fractions grown under iron-replete vs. iron-starved conditions supported the physiological importance of the iron acquisition systems Ybt, Yfe, Yfu, Yiu and Hmu. An uncharacterized TonB-dependent OM receptor, Y0850, was also highly abundant in iron-depleted cells, appeared to be Fur-regulated and may participate in iron uptake. Numerous enzymes harboring iron and Fe-S cluster cofactors were significantly

decreased in abundance in iron-starved cells, suggesting a regulatory process shifting the metabolism of Y. pestis to iron-independent Z-VAD-FMK concentration pathways when the supply of this metal ion is limited. Small Fur-regulated RNAs termed RyhB in E. coli may be involved in this process. Finally, this study revealed biochemical pathways likely essential for the iron starvation response in Y. pestis. Examples are the energy metabolism via the pyruvate oxidase route and Fe-S cluster assembly mediated by the Suf system. Acknowledgements This work was performed under the Pathogen Functional Genomics Resource Center contract (contract No. N01-AI15447), funded by the National Institute of Allergy and Infectious Diseases, National Institutes of Health. We thank Jasmine Pollard for the graphic presented in Figure 4, Christine Bunai for the development of the mass spectrometry analysis platform

and John Braisted for advice on statistical data analysis methods. Electronic supplementary material Additional file 1: Yersinia pestis growth curves in PMH2 medium. Growth curves (OD600) are displayed in graphical form for Y. pestis KIM6+ cell cultures in iron rich and iron-depleted media, at 26°C and at 37°C. (DOC 133 KB) Additional file 2: Comprehensive list of differentially displayed Yersinia pestis proteins comparing iron-replete and iron starvation Nintedanib (BIBF 1120) conditions. A variety of qualitative and quantitative data are provided for differentially displayed proteins derived from + Fe vs. -Fe growth conditions, from cell cultures at 26°C and at 37°C. (XLS 130 KB) Additional file 3: Comprehensive list of MS and MS 2 data for Y. pestis KIM6+ proteins. For all proteins listed in the Tables 1, 2 and 3 and in the Additional File 2, MS and MS2 data were parsed from MALDI-TOFTOF and LC-nESI-LC-MS/MS datasets. (XLS 6 MB) References 1. Brubaker RR, Sussman M: Yersinia pestis. In Molecular Medical Microbiology. Volume 3.

All statistical analyses were performed using SPSS (version 16.0; SPSS Inc., MS-275 mouse Chicago, IL, USA). Results Characteristics of the GOOD cohort The characteristics of the young men, including current anthropometric

data, as well as at the time of birth, calcium intake, smoking (yes or no), current level of physical activity (hours/week), total body adipose tissue, and lean mass are given in Table 1. Parental characteristics, including maternal and paternal age, maternal anthropometrics, maternal smoking in early pregnancy, maternal parity, length of pregnancy, vaginal delivery, or caesarian section and socioeconomic index of the household in 1985, are also presented in Table 1. Bone parameters, including aBMD, BMC and area of the total body, lumbar spine, femoral neck and the non-dominant radius, and cortical and trabecular vBMD, cortical cross-sectional area, periosteal and endosteal

circumference of the non-dominant radius are given in Table 2. Table 1 Anthropometric characteristics, environmental factors, and circumstances at the time of birth of men in the GOOD cohort as well as parental characteristics Variables No. Mean ± SD GOOD cohort  Age (year) 1,009 18.9 ± 0.6  Height (cm) 1,009 181.7 ± 6.6  Weight (kg) 1,009 74.0 ± 11.9  Calcium intake (mg/day) 1,009 1,108 ± 727  Smoking (%) 1,009 9.0  Physical activity (hours/week) 1,009 4.3 ± 5.2  Total body adipose tissue (kg) 1,009 13.4 ± 8.0  Total body lean mass (kg) 1,009 57.6 ± 6.1  Birth height (cm) 998 50.8 ± 2.1  Birth weight (g) 977 3,580 ± 547 Parental variables at the time of childbirth  Maternal age (year) 1,009 29.5 ± 4.8  Paternal age (year) 1,002 32.6 ± 5.5  Maternal height (cm) 832 167.1 ± 5.8  Maternal AZD2014 mouse weight before pregnancy (kg) 885 60.5 ± 8.2  Maternal

smoking in early pregnancy (%) 967 25.7  Maternal parity (n) 1,009 1.65 ± 0.83  Vaginal delivery (%) 1,008 86.0  Caesarean section (%) 1,008 14.0  Length of pregnancy (day) 1,009 278 ± 12  Socioeconomic index of the household 1985a 960 2.04 ± 0.77 Table 1. Mean values and standard deviations aBMD areal bone mineral density; BMC bone mineral content aSocioeconomic index given from 1 to 3, where 1 is lower social position and 3 is higher Table 2 Bone parameters and their correlation and association with maternal age Bone variables Mean ± SDa learn more r valuea β-coefficientsb β-coefficientsc β-coefficientsd DXA Total body aBMD (g/cm2) 1.25 ± 0.10 −0.070* −0.036 −0.032 −0.031 Lumbar spine aBMD (g/cm2) 1.24 ± 0.15 −0.092** −0.076** −0.076** −0.091** Femoral neck aBMD (g/cm2) 1.17 ± 0.16 −0.021 −0.006 0.001 0.007 Radius non-dominant aBMD (g/cm2) 0.58 ± 0.06 −0.062* −0.035 −0.005 −0.004 Total body BMC (g) 3,209 ± 447 −0.055 −0.040* −0.038 −0.033 Lumbar spine BMC (g) 61.5 ± 10.9 −0.081* −0.078** −0.084** −0.090** Femoral neck BMC (g) 6.45 ± 1.07 −0.029 −0.013 −0.013 −0.003 Radius non-dominant BMC (g) 10.1 ± 1.5 −0.077* −0.075*** −0.071** −0.069** Total body area (cm2) 2,561 ± 198 −0.026 −0.034 −0.036 −0.031 Lumbar spine area (cm2) 49.

2 derivative carrying the mini-Tn5 between 151-152 bp position of rosR [30] Rt2441 Rt24.2 with additional rosR upstream region introduced by pM41 integration, Kmr, Nxr This work E. coli     DH5α supE44 ΔlacU169 (φ80 lacZΔ M15) hsdR17 recA1endA1gyrA96 thi-1 relA1 [67] S17-1 294 derivative RP4-2Tc::Mu-Km::Tn7 chromosomally integrated [79] Plasmids

    pK19mobGII mob, lacZα, gusA, Kmr [80] pBBR1MCS-2 mob, lacZα, Kmr [81] pB31 pUC19 with 1174-bp BamHI fragment containing Rt24.2 rosR [23] pM41 pK19mobGII with 586-bp EcoRI-PstI fragment from pB31 containing the rosR upstream region This work pRC24 PLX4032 price pRK7813 with 1174-bp BamHI fragment containing rosR of Rt24.2 [23] pBR24 pBBR1MCS-5 with 1174-bp BamHI fragment containing rosR of Rt24.2 [23] pEX1 pBBR1MCS-2 with 586-bp EcoRI-PstI fragment containing the upstream region and the first 60 codons for RosR This work pEX8 pBBR1MCS-2 with 372-bp EcoRI-XbaI fragment containing the -403

bp to -32 bp rosR upstream region This work pEX9 pBBR1MCS-2 with 219-bp EcoRI-XbaI fragment containing the -403 bp to -185 bp rosR upstream region This work pEX60 pBBR1MCS-2 with 278-bp (-96 bp to +182 bp) EcoRI-PstI fragment containing the first 60 codons for RosR cloned downstream the vector promoter This work pBR28 pBBR1MCS-2 with 820-bp (-96 bp to +724 bp) EcoRI-BamHI fragment containing the full-length rosR cloned downstream the vector promoter This work pHC60 Vector with gfp and RK2 stabilization fragment, Tcr [39] Oligonucleotide primers Sequence (5′-3′) *   pEP1 ATGCAAGAATTCTGCACAGGAAGC

[23] pEP5 CGGTCAGGAATTCTAAGAACAGGT [23] pEP6 Idoxuridine TCGAAACAGGAATTCGATTCCTGC [23] pRR1 CGCATTCTAGACATGTGATCTGCT [23] pEP8 GPCR Compound Library AACGGCTCTAGACTGACACGCCAAA [23] pEP9 TCATGCTCTAGACGATGGCCTCAGT [23] rosA GCGGATCCGCGACTTTACCAGATTTA [23] rosB GTCACGCTCTTCGGAATTCAGGGGT [23] rosC AGGGATCCATTCTAAACCTGTCGGCA [23] rosD TCGGATCCTGTCGGCAAAGCATAAGA [23] rosG1 GACGATCGAATTCGGCCGTCTCTT This work rosD4 TTGCGGATCCGCAGATGCCGGT This work rosD5 ACCACGCCTGGGATCCAGGAAAA This work * Sequences for EcoRI, BamHI and XbaI restriction sites are underlined. To assay the effect of clover root exudates on growth of the rosR mutants (Rt2441 and Rt2472) and the wild type, the strains were grown in 5 ml M1 medium supplemented with 5 μM exudates, which was prepared as described previously [69]. After 24, 48, 72, and 96 h, 100 μl aliquots of each culture were removed and plated in dilutions on 79CA plates, incubated 4 days at 28°C, and the colonies were counted. DNA methods: construction of Rt2441 rosR mutant and plasmids containing different fragments of the rosR upstream region and rosR ORF Standard techniques were used for DNA isolation, restriction enzyme digestion, cloning, and Southern hybridization [67]. For PCR amplifications, Ready Taq PCR Reaction Mix (Sigma) or PfuI polymerase (Fermentas) was used. Sequencing was performed using the BigDye terminator cycle sequencing kit (Applied Biosystems) and the ABI Prism 310 sequencer.